The following sequence contains an open reading frame (ORF) in one of their 6 reading frames.
- Use the EMBL-EBI web based sequence tool to translate the sequences below.
(http://www.ebi.ac.uk/Tools/emboss/transeq/index.html)
Find the ORF in the correct reading frame (you must select “6” under the frames pull down menu before translating to see all 6 frames). - Once you find the ORF protein sequence, perform a BLAST search at the EcoCyc web site (http://www.ecocyc.org/, located in the search menu) to determine the identity and function of the protein.
- Report the correct reading frame (+3, +2, +1, -1, -2, or -3), the translated sequence from the start methionine to the stop codon (you can assume the first methionine in the correct reading frame is the start methionine), the encoded protein name, and a brief description of its function.
Sequence #8:
GAGGAAGAGATGGAAACTATCGCTAAACATCGCCATGCTCGTTCTTCTGCTCAGAAGGTT
CGCCTTGTTGCTGACCTGATTCGCGGTAAGAAAGTGTCGCAGGCTCTGGATATTTTGACC
TACACCAACAAGAAAGCGGCTGTACTGGTCAAGAAAGTTCTGGAATCTGCCATTGCTAAC
GCTGAACACAACGATGGCGCTGACATTGACGATCTGAAAGTTACGAAAATTTTCGTAGAC
GAAGGCCCGAGCATGAAGCGCATTATGCCGCGTGCAAAAGGTCGTGCAGATCGCATCCTG
AAGCGCACCAGCCACATCACTGTGGTTGTGTCCGATCGCTGAGACTCTGGAG