You are studying regulation of gene expression, specifically sigma factors and their interactions with RNA polymerase.  The postdoc you are working with has identified an interesting sigma factor and she would like you to carry out analysis on it.  The following sequence contains an open reading frame (ORF) in one of its 6 reading frames.

    1. Use the EMBL-EBI web based sequence tool to translate the sequence  (http://www.ebi.ac.uk/Tools/emboss/transeq/index.html) and find the ORF in the correct reading frame (you must select “6” under the frames pull down menu before translating to see all 6 frames).  Report the correct reading frame (+3, +2, +1, -1, -2, or -3).  You can assume the first methionine in the correct reading frame is the start methionine.

CGGTTGGGTCAAACGAGTTGTTTACGCTGGTTTGACGGCGGAATGGATAAAGACTCTCGGTACTTCGCAACAGTGCGGCGTGCCACCATGATACCTTGTTCCGACAGCAAAGAGGTTAACTTGCTGTCGCTCAACGGTTTCGCTGGGTTTTCCGCCGCGATTAATTTCTTCACCAGCGCACGAATCGCCGTGGAGGAAGCTTCGCCGCCGCCCTCGGTATTGACGTGACTGGAAAAGAAATACTTCAGTTCAAAAATGCCTCGTGGACTATGCAGGTATTTTTGCGTGGTCACGCGAGATATCGTCGATTCATGCATTTCGACAGCCTGGGCGATATCGGCCAGTACCATCGGTTTCATATATTCTTCACCTTGCTCAAAGAAGGCTTGCTGCTGTTCAACGATACAGCGACTCACGCGCAGTAGCGTATCGTTACGGCTTTCCAGACTCTTGATCAACCATTTGGCATCCTGCAGATTGCTGCGGATAAACTGGCTGTCACCATCGTTGCGCGCGTTATTGCACATCGAGGCGTAGTGCTGGTTGATTTGCAGACGCGGAATGCTGTCACTGTTGAGTTCTACCGTCCAGTGACCGTTATGCTTACGCACCAGCACATCTGGAATGACATACTCAGGTTCGCCAGTCTGGATCGACTGCCCGGGGCGCGGATCGAGCGACTGGATCAGATTGACGGCTTCTTTCAGCACATCTTCTTTCAGACGCGTGACGCGCATTAAAGTGCGGAAGTCGTGATTGGCTAACAGATCGAGATGATCGCTAATGATCAGTCTGGCCTCTTCCAGCCACGGCGTGGTCTTATCGAATTGGGAGAGTTGGATCAGCAGACAGTCACGCAGATCTTTTGCCGCCACACCGACCGGATCAAACCGTTGGATCCGCTTAAGGACGGCTTCAACTTCGTCGATGTCGATCTCTTCATCGCCTATACTTTCGAGAATATCTTCCAGCGGGACAGTCAGATAACCGGTTTCATCAACGGCATCGACGATAGAGGTAGCAATAGCGCGGTCAGTGTCGGAAAACGGTGTCAGCTCAACCTGCCACATCAGGTAATCCTGCAAGGTCTGCGTCGTTTCGCCCTGGTAGACCGGCAGCTCGTCGTCAATGTAGTCACCGCTGGTGCCGGATGGTGTACCAGCGGTGTAAATGGTGTCCCAACTGGCATCGAGCGGCAGCTCTTCCGGCATCTCTTTTTGTTCGAGCGCGTCGGCGGTGTCCAGCGTTTCACTGTCTTGCGTTTCGCGGGTGTCGATTTCTTCATGAGTGTCGATTTGCTCAAGCAGCGGATTACTCTCCAGCGCCTGCTGTAGCTCCTGCTGAAGTTCCAGCGTCGACAACTGCAACAGACGAATTGCCTGTTGGAGCTGTGGCGTCATCGCCAGTTGTTGGCTAAGCCTGAGTTGCAAACCTTGCTTCATGTTCAGAATC

    1. Use the EcoCyc BLASTp function (using the correct protein sequence from part a) to determine the protein name and function(s) of this sequence.

 

    1. Record the Score, E-value and % Identity of the top hit.

 

    1. How does BLASTp differ from BLASTx?

 

    1. What two different structural motifs allow this sigma factor to bind to the promoter  sequence?

 

    1. Sigma 54 requires activation by NtrC-phosphate to be in the correct conformational state to bind to the promoter sequence.  What type and how many amino acid residues are important for Sigma 54 to be activated by the NtrC-phosphate?

 

    1. You are curious to compare the amino acid sequence of Sigma 54 from E. coli (sequence from part b) to orthologs found in a Gram-positive organism, Bacillus subtilis subtilis 168, and the sister group to E.coli, Shigella flexneri 2002017.  Use BLASTpand record the name of the top hit and its Score, E-value, and % Identity for each bacterium separately (do not forget to “Change Organism Database” before repeating this BLASTp).  Based on the BLASTp statistics, which one is a better hit, or are they comparable?  Why?